ID: 1128749376

View in Genome Browser
Species Human (GRCh38)
Location 15:70138086-70138108
Sequence CTCCTTAGGCAGCTGGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128749376_1128749386 5 Left 1128749376 15:70138086-70138108 CCATGGCCCAGCTGCCTAAGGAG No data
Right 1128749386 15:70138114-70138136 GCAGGCAGGGTGTGAGCCTCTGG No data
1128749376_1128749388 21 Left 1128749376 15:70138086-70138108 CCATGGCCCAGCTGCCTAAGGAG No data
Right 1128749388 15:70138130-70138152 CCTCTGGATAATTTCTTTTCTGG No data
1128749376_1128749385 -8 Left 1128749376 15:70138086-70138108 CCATGGCCCAGCTGCCTAAGGAG No data
Right 1128749385 15:70138101-70138123 CTAAGGAGGCAGGGCAGGCAGGG No data
1128749376_1128749384 -9 Left 1128749376 15:70138086-70138108 CCATGGCCCAGCTGCCTAAGGAG No data
Right 1128749384 15:70138100-70138122 CCTAAGGAGGCAGGGCAGGCAGG No data
1128749376_1128749389 22 Left 1128749376 15:70138086-70138108 CCATGGCCCAGCTGCCTAAGGAG No data
Right 1128749389 15:70138131-70138153 CTCTGGATAATTTCTTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128749376 Original CRISPR CTCCTTAGGCAGCTGGGCCA TGG (reversed) Intergenic
No off target data available for this crispr