ID: 1128750003

View in Genome Browser
Species Human (GRCh38)
Location 15:70141989-70142011
Sequence CTCCCGCGTGGCGCTGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128750000_1128750003 1 Left 1128750000 15:70141965-70141987 CCTGAATTCTGGCTTGAACAAAA No data
Right 1128750003 15:70141989-70142011 CTCCCGCGTGGCGCTGAAGGTGG No data
1128749999_1128750003 2 Left 1128749999 15:70141964-70141986 CCCTGAATTCTGGCTTGAACAAA No data
Right 1128750003 15:70141989-70142011 CTCCCGCGTGGCGCTGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128750003 Original CRISPR CTCCCGCGTGGCGCTGAAGG TGG Intergenic
No off target data available for this crispr