ID: 1128755455

View in Genome Browser
Species Human (GRCh38)
Location 15:70180726-70180748
Sequence GCGTCAGGACGGGTAGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128755455_1128755464 26 Left 1128755455 15:70180726-70180748 CCCGCCTCTACCCGTCCTGACGC No data
Right 1128755464 15:70180775-70180797 CATCCACATACAAATGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128755455 Original CRISPR GCGTCAGGACGGGTAGAGGC GGG (reversed) Intergenic
No off target data available for this crispr