ID: 1128755456

View in Genome Browser
Species Human (GRCh38)
Location 15:70180727-70180749
Sequence AGCGTCAGGACGGGTAGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128755456_1128755464 25 Left 1128755456 15:70180727-70180749 CCGCCTCTACCCGTCCTGACGCT No data
Right 1128755464 15:70180775-70180797 CATCCACATACAAATGATCTTGG No data
1128755456_1128755466 30 Left 1128755456 15:70180727-70180749 CCGCCTCTACCCGTCCTGACGCT No data
Right 1128755466 15:70180780-70180802 ACATACAAATGATCTTGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128755456 Original CRISPR AGCGTCAGGACGGGTAGAGG CGG (reversed) Intergenic
No off target data available for this crispr