ID: 1128755457

View in Genome Browser
Species Human (GRCh38)
Location 15:70180730-70180752
Sequence GTCAGCGTCAGGACGGGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128755457_1128755464 22 Left 1128755457 15:70180730-70180752 CCTCTACCCGTCCTGACGCTGAC No data
Right 1128755464 15:70180775-70180797 CATCCACATACAAATGATCTTGG No data
1128755457_1128755467 28 Left 1128755457 15:70180730-70180752 CCTCTACCCGTCCTGACGCTGAC No data
Right 1128755467 15:70180781-70180803 CATACAAATGATCTTGGTTTGGG No data
1128755457_1128755466 27 Left 1128755457 15:70180730-70180752 CCTCTACCCGTCCTGACGCTGAC No data
Right 1128755466 15:70180780-70180802 ACATACAAATGATCTTGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128755457 Original CRISPR GTCAGCGTCAGGACGGGTAG AGG (reversed) Intergenic