ID: 1128755463

View in Genome Browser
Species Human (GRCh38)
Location 15:70180758-70180780
Sequence TGGATGCACGTGTGTGCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128755463_1128755467 0 Left 1128755463 15:70180758-70180780 CCACGTGCACACACGTGCATCCA No data
Right 1128755467 15:70180781-70180803 CATACAAATGATCTTGGTTTGGG No data
1128755463_1128755469 23 Left 1128755463 15:70180758-70180780 CCACGTGCACACACGTGCATCCA No data
Right 1128755469 15:70180804-70180826 TTCTTCCAAAAGCGGAGTCAAGG No data
1128755463_1128755466 -1 Left 1128755463 15:70180758-70180780 CCACGTGCACACACGTGCATCCA No data
Right 1128755466 15:70180780-70180802 ACATACAAATGATCTTGGTTTGG No data
1128755463_1128755464 -6 Left 1128755463 15:70180758-70180780 CCACGTGCACACACGTGCATCCA No data
Right 1128755464 15:70180775-70180797 CATCCACATACAAATGATCTTGG No data
1128755463_1128755468 15 Left 1128755463 15:70180758-70180780 CCACGTGCACACACGTGCATCCA No data
Right 1128755468 15:70180796-70180818 GGTTTGGGTTCTTCCAAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128755463 Original CRISPR TGGATGCACGTGTGTGCACG TGG (reversed) Intergenic
No off target data available for this crispr