ID: 1128755464

View in Genome Browser
Species Human (GRCh38)
Location 15:70180775-70180797
Sequence CATCCACATACAAATGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128755459_1128755464 15 Left 1128755459 15:70180737-70180759 CCGTCCTGACGCTGACCCTCTCC No data
Right 1128755464 15:70180775-70180797 CATCCACATACAAATGATCTTGG No data
1128755461_1128755464 0 Left 1128755461 15:70180752-70180774 CCCTCTCCACGTGCACACACGTG No data
Right 1128755464 15:70180775-70180797 CATCCACATACAAATGATCTTGG No data
1128755457_1128755464 22 Left 1128755457 15:70180730-70180752 CCTCTACCCGTCCTGACGCTGAC No data
Right 1128755464 15:70180775-70180797 CATCCACATACAAATGATCTTGG No data
1128755456_1128755464 25 Left 1128755456 15:70180727-70180749 CCGCCTCTACCCGTCCTGACGCT No data
Right 1128755464 15:70180775-70180797 CATCCACATACAAATGATCTTGG No data
1128755455_1128755464 26 Left 1128755455 15:70180726-70180748 CCCGCCTCTACCCGTCCTGACGC No data
Right 1128755464 15:70180775-70180797 CATCCACATACAAATGATCTTGG No data
1128755463_1128755464 -6 Left 1128755463 15:70180758-70180780 CCACGTGCACACACGTGCATCCA No data
Right 1128755464 15:70180775-70180797 CATCCACATACAAATGATCTTGG No data
1128755458_1128755464 16 Left 1128755458 15:70180736-70180758 CCCGTCCTGACGCTGACCCTCTC No data
Right 1128755464 15:70180775-70180797 CATCCACATACAAATGATCTTGG No data
1128755454_1128755464 27 Left 1128755454 15:70180725-70180747 CCCCGCCTCTACCCGTCCTGACG No data
Right 1128755464 15:70180775-70180797 CATCCACATACAAATGATCTTGG No data
1128755462_1128755464 -1 Left 1128755462 15:70180753-70180775 CCTCTCCACGTGCACACACGTGC No data
Right 1128755464 15:70180775-70180797 CATCCACATACAAATGATCTTGG No data
1128755460_1128755464 11 Left 1128755460 15:70180741-70180763 CCTGACGCTGACCCTCTCCACGT No data
Right 1128755464 15:70180775-70180797 CATCCACATACAAATGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128755464 Original CRISPR CATCCACATACAAATGATCT TGG Intergenic