ID: 1128755467 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:70180781-70180803 |
Sequence | CATACAAATGATCTTGGTTT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 7 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1128755462_1128755467 | 5 | Left | 1128755462 | 15:70180753-70180775 | CCTCTCCACGTGCACACACGTGC | No data | ||
Right | 1128755467 | 15:70180781-70180803 | CATACAAATGATCTTGGTTTGGG | No data | ||||
1128755458_1128755467 | 22 | Left | 1128755458 | 15:70180736-70180758 | CCCGTCCTGACGCTGACCCTCTC | No data | ||
Right | 1128755467 | 15:70180781-70180803 | CATACAAATGATCTTGGTTTGGG | No data | ||||
1128755461_1128755467 | 6 | Left | 1128755461 | 15:70180752-70180774 | CCCTCTCCACGTGCACACACGTG | No data | ||
Right | 1128755467 | 15:70180781-70180803 | CATACAAATGATCTTGGTTTGGG | No data | ||||
1128755459_1128755467 | 21 | Left | 1128755459 | 15:70180737-70180759 | CCGTCCTGACGCTGACCCTCTCC | No data | ||
Right | 1128755467 | 15:70180781-70180803 | CATACAAATGATCTTGGTTTGGG | No data | ||||
1128755463_1128755467 | 0 | Left | 1128755463 | 15:70180758-70180780 | CCACGTGCACACACGTGCATCCA | No data | ||
Right | 1128755467 | 15:70180781-70180803 | CATACAAATGATCTTGGTTTGGG | No data | ||||
1128755460_1128755467 | 17 | Left | 1128755460 | 15:70180741-70180763 | CCTGACGCTGACCCTCTCCACGT | No data | ||
Right | 1128755467 | 15:70180781-70180803 | CATACAAATGATCTTGGTTTGGG | No data | ||||
1128755457_1128755467 | 28 | Left | 1128755457 | 15:70180730-70180752 | CCTCTACCCGTCCTGACGCTGAC | No data | ||
Right | 1128755467 | 15:70180781-70180803 | CATACAAATGATCTTGGTTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1128755467 | Original CRISPR | CATACAAATGATCTTGGTTT GGG | Intergenic | ||