ID: 1128756584

View in Genome Browser
Species Human (GRCh38)
Location 15:70187547-70187569
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128756572_1128756584 15 Left 1128756572 15:70187509-70187531 CCTCCTAGCAGGGTCCCACTCAC No data
Right 1128756584 15:70187547-70187569 ACGTGTGTGGGCAGCTCCCTTGG No data
1128756573_1128756584 12 Left 1128756573 15:70187512-70187534 CCTAGCAGGGTCCCACTCACATG No data
Right 1128756584 15:70187547-70187569 ACGTGTGTGGGCAGCTCCCTTGG No data
1128756581_1128756584 0 Left 1128756581 15:70187524-70187546 CCACTCACATGGTGGGGGAGGAC No data
Right 1128756584 15:70187547-70187569 ACGTGTGTGGGCAGCTCCCTTGG No data
1128756580_1128756584 1 Left 1128756580 15:70187523-70187545 CCCACTCACATGGTGGGGGAGGA No data
Right 1128756584 15:70187547-70187569 ACGTGTGTGGGCAGCTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128756584 Original CRISPR ACGTGTGTGGGCAGCTCCCT TGG Intergenic
No off target data available for this crispr