ID: 1128757109

View in Genome Browser
Species Human (GRCh38)
Location 15:70190558-70190580
Sequence GCTGCTGTTTGGAGCCATCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128757109_1128757114 1 Left 1128757109 15:70190558-70190580 CCTCGATGGCTCCAAACAGCAGC No data
Right 1128757114 15:70190582-70190604 TGGGCTGCCTACCATTGCCTTGG No data
1128757109_1128757115 2 Left 1128757109 15:70190558-70190580 CCTCGATGGCTCCAAACAGCAGC No data
Right 1128757115 15:70190583-70190605 GGGCTGCCTACCATTGCCTTGGG No data
1128757109_1128757119 24 Left 1128757109 15:70190558-70190580 CCTCGATGGCTCCAAACAGCAGC No data
Right 1128757119 15:70190605-70190627 GATGCTTTTTTATTTCCATTTGG No data
1128757109_1128757120 29 Left 1128757109 15:70190558-70190580 CCTCGATGGCTCCAAACAGCAGC No data
Right 1128757120 15:70190610-70190632 TTTTTTATTTCCATTTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128757109 Original CRISPR GCTGCTGTTTGGAGCCATCG AGG (reversed) Intergenic
No off target data available for this crispr