ID: 1128757899

View in Genome Browser
Species Human (GRCh38)
Location 15:70195837-70195859
Sequence TCAGCAAGGCCCTGGGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128757899_1128757908 -3 Left 1128757899 15:70195837-70195859 CCTGAGCCCCAGGGCCTTGCTGA No data
Right 1128757908 15:70195857-70195879 TGATGGCAGGCTGACTGCTGGGG No data
1128757899_1128757909 11 Left 1128757899 15:70195837-70195859 CCTGAGCCCCAGGGCCTTGCTGA No data
Right 1128757909 15:70195871-70195893 CTGCTGGGGCACCCCCAGACAGG No data
1128757899_1128757907 -4 Left 1128757899 15:70195837-70195859 CCTGAGCCCCAGGGCCTTGCTGA No data
Right 1128757907 15:70195856-70195878 CTGATGGCAGGCTGACTGCTGGG No data
1128757899_1128757906 -5 Left 1128757899 15:70195837-70195859 CCTGAGCCCCAGGGCCTTGCTGA No data
Right 1128757906 15:70195855-70195877 GCTGATGGCAGGCTGACTGCTGG No data
1128757899_1128757910 18 Left 1128757899 15:70195837-70195859 CCTGAGCCCCAGGGCCTTGCTGA No data
Right 1128757910 15:70195878-70195900 GGCACCCCCAGACAGGCCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128757899 Original CRISPR TCAGCAAGGCCCTGGGGCTC AGG (reversed) Intergenic
No off target data available for this crispr