ID: 1128757901

View in Genome Browser
Species Human (GRCh38)
Location 15:70195843-70195865
Sequence CTGCCATCAGCAAGGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128757901_1128757909 5 Left 1128757901 15:70195843-70195865 CCCCAGGGCCTTGCTGATGGCAG No data
Right 1128757909 15:70195871-70195893 CTGCTGGGGCACCCCCAGACAGG No data
1128757901_1128757908 -9 Left 1128757901 15:70195843-70195865 CCCCAGGGCCTTGCTGATGGCAG No data
Right 1128757908 15:70195857-70195879 TGATGGCAGGCTGACTGCTGGGG No data
1128757901_1128757916 30 Left 1128757901 15:70195843-70195865 CCCCAGGGCCTTGCTGATGGCAG No data
Right 1128757916 15:70195896-70195918 AACGGAGCCAAGCCGACAGCCGG No data
1128757901_1128757907 -10 Left 1128757901 15:70195843-70195865 CCCCAGGGCCTTGCTGATGGCAG No data
Right 1128757907 15:70195856-70195878 CTGATGGCAGGCTGACTGCTGGG No data
1128757901_1128757910 12 Left 1128757901 15:70195843-70195865 CCCCAGGGCCTTGCTGATGGCAG No data
Right 1128757910 15:70195878-70195900 GGCACCCCCAGACAGGCCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128757901 Original CRISPR CTGCCATCAGCAAGGCCCTG GGG (reversed) Intergenic
No off target data available for this crispr