ID: 1128757902

View in Genome Browser
Species Human (GRCh38)
Location 15:70195844-70195866
Sequence CCTGCCATCAGCAAGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128757902_1128757916 29 Left 1128757902 15:70195844-70195866 CCCAGGGCCTTGCTGATGGCAGG No data
Right 1128757916 15:70195896-70195918 AACGGAGCCAAGCCGACAGCCGG No data
1128757902_1128757917 30 Left 1128757902 15:70195844-70195866 CCCAGGGCCTTGCTGATGGCAGG No data
Right 1128757917 15:70195897-70195919 ACGGAGCCAAGCCGACAGCCGGG No data
1128757902_1128757909 4 Left 1128757902 15:70195844-70195866 CCCAGGGCCTTGCTGATGGCAGG No data
Right 1128757909 15:70195871-70195893 CTGCTGGGGCACCCCCAGACAGG No data
1128757902_1128757908 -10 Left 1128757902 15:70195844-70195866 CCCAGGGCCTTGCTGATGGCAGG No data
Right 1128757908 15:70195857-70195879 TGATGGCAGGCTGACTGCTGGGG No data
1128757902_1128757910 11 Left 1128757902 15:70195844-70195866 CCCAGGGCCTTGCTGATGGCAGG No data
Right 1128757910 15:70195878-70195900 GGCACCCCCAGACAGGCCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128757902 Original CRISPR CCTGCCATCAGCAAGGCCCT GGG (reversed) Intergenic
No off target data available for this crispr