ID: 1128757905

View in Genome Browser
Species Human (GRCh38)
Location 15:70195851-70195873
Sequence CAGTCAGCCTGCCATCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128757905_1128757919 30 Left 1128757905 15:70195851-70195873 CCTTGCTGATGGCAGGCTGACTG No data
Right 1128757919 15:70195904-70195926 CAAGCCGACAGCCGGGAGAGAGG No data
1128757905_1128757910 4 Left 1128757905 15:70195851-70195873 CCTTGCTGATGGCAGGCTGACTG No data
Right 1128757910 15:70195878-70195900 GGCACCCCCAGACAGGCCAACGG No data
1128757905_1128757917 23 Left 1128757905 15:70195851-70195873 CCTTGCTGATGGCAGGCTGACTG No data
Right 1128757917 15:70195897-70195919 ACGGAGCCAAGCCGACAGCCGGG No data
1128757905_1128757916 22 Left 1128757905 15:70195851-70195873 CCTTGCTGATGGCAGGCTGACTG No data
Right 1128757916 15:70195896-70195918 AACGGAGCCAAGCCGACAGCCGG No data
1128757905_1128757909 -3 Left 1128757905 15:70195851-70195873 CCTTGCTGATGGCAGGCTGACTG No data
Right 1128757909 15:70195871-70195893 CTGCTGGGGCACCCCCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128757905 Original CRISPR CAGTCAGCCTGCCATCAGCA AGG (reversed) Intergenic
No off target data available for this crispr