ID: 1128757908

View in Genome Browser
Species Human (GRCh38)
Location 15:70195857-70195879
Sequence TGATGGCAGGCTGACTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128757899_1128757908 -3 Left 1128757899 15:70195837-70195859 CCTGAGCCCCAGGGCCTTGCTGA No data
Right 1128757908 15:70195857-70195879 TGATGGCAGGCTGACTGCTGGGG No data
1128757898_1128757908 2 Left 1128757898 15:70195832-70195854 CCTGGCCTGAGCCCCAGGGCCTT No data
Right 1128757908 15:70195857-70195879 TGATGGCAGGCTGACTGCTGGGG No data
1128757902_1128757908 -10 Left 1128757902 15:70195844-70195866 CCCAGGGCCTTGCTGATGGCAGG No data
Right 1128757908 15:70195857-70195879 TGATGGCAGGCTGACTGCTGGGG No data
1128757901_1128757908 -9 Left 1128757901 15:70195843-70195865 CCCCAGGGCCTTGCTGATGGCAG No data
Right 1128757908 15:70195857-70195879 TGATGGCAGGCTGACTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128757908 Original CRISPR TGATGGCAGGCTGACTGCTG GGG Intergenic
No off target data available for this crispr