ID: 1128757911

View in Genome Browser
Species Human (GRCh38)
Location 15:70195882-70195904
Sequence GGCTCCGTTGGCCTGTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128757911_1128757917 -8 Left 1128757911 15:70195882-70195904 CCCCCAGACAGGCCAACGGAGCC No data
Right 1128757917 15:70195897-70195919 ACGGAGCCAAGCCGACAGCCGGG No data
1128757911_1128757923 21 Left 1128757911 15:70195882-70195904 CCCCCAGACAGGCCAACGGAGCC No data
Right 1128757923 15:70195926-70195948 GCCTGCTCTCCCACACACGTGGG No data
1128757911_1128757916 -9 Left 1128757911 15:70195882-70195904 CCCCCAGACAGGCCAACGGAGCC No data
Right 1128757916 15:70195896-70195918 AACGGAGCCAAGCCGACAGCCGG No data
1128757911_1128757919 -1 Left 1128757911 15:70195882-70195904 CCCCCAGACAGGCCAACGGAGCC No data
Right 1128757919 15:70195904-70195926 CAAGCCGACAGCCGGGAGAGAGG No data
1128757911_1128757922 20 Left 1128757911 15:70195882-70195904 CCCCCAGACAGGCCAACGGAGCC No data
Right 1128757922 15:70195925-70195947 GGCCTGCTCTCCCACACACGTGG No data
1128757911_1128757926 29 Left 1128757911 15:70195882-70195904 CCCCCAGACAGGCCAACGGAGCC No data
Right 1128757926 15:70195934-70195956 TCCCACACACGTGGGAATGAGGG No data
1128757911_1128757925 28 Left 1128757911 15:70195882-70195904 CCCCCAGACAGGCCAACGGAGCC No data
Right 1128757925 15:70195933-70195955 CTCCCACACACGTGGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128757911 Original CRISPR GGCTCCGTTGGCCTGTCTGG GGG (reversed) Intergenic