ID: 1128757912

View in Genome Browser
Species Human (GRCh38)
Location 15:70195883-70195905
Sequence TGGCTCCGTTGGCCTGTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128757912_1128757923 20 Left 1128757912 15:70195883-70195905 CCCCAGACAGGCCAACGGAGCCA No data
Right 1128757923 15:70195926-70195948 GCCTGCTCTCCCACACACGTGGG No data
1128757912_1128757922 19 Left 1128757912 15:70195883-70195905 CCCCAGACAGGCCAACGGAGCCA No data
Right 1128757922 15:70195925-70195947 GGCCTGCTCTCCCACACACGTGG No data
1128757912_1128757919 -2 Left 1128757912 15:70195883-70195905 CCCCAGACAGGCCAACGGAGCCA No data
Right 1128757919 15:70195904-70195926 CAAGCCGACAGCCGGGAGAGAGG No data
1128757912_1128757926 28 Left 1128757912 15:70195883-70195905 CCCCAGACAGGCCAACGGAGCCA No data
Right 1128757926 15:70195934-70195956 TCCCACACACGTGGGAATGAGGG No data
1128757912_1128757925 27 Left 1128757912 15:70195883-70195905 CCCCAGACAGGCCAACGGAGCCA No data
Right 1128757925 15:70195933-70195955 CTCCCACACACGTGGGAATGAGG No data
1128757912_1128757916 -10 Left 1128757912 15:70195883-70195905 CCCCAGACAGGCCAACGGAGCCA No data
Right 1128757916 15:70195896-70195918 AACGGAGCCAAGCCGACAGCCGG No data
1128757912_1128757917 -9 Left 1128757912 15:70195883-70195905 CCCCAGACAGGCCAACGGAGCCA No data
Right 1128757917 15:70195897-70195919 ACGGAGCCAAGCCGACAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128757912 Original CRISPR TGGCTCCGTTGGCCTGTCTG GGG (reversed) Intergenic
No off target data available for this crispr