ID: 1128757915

View in Genome Browser
Species Human (GRCh38)
Location 15:70195894-70195916
Sequence GGCTGTCGGCTTGGCTCCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128757915_1128757925 16 Left 1128757915 15:70195894-70195916 CCAACGGAGCCAAGCCGACAGCC No data
Right 1128757925 15:70195933-70195955 CTCCCACACACGTGGGAATGAGG No data
1128757915_1128757922 8 Left 1128757915 15:70195894-70195916 CCAACGGAGCCAAGCCGACAGCC No data
Right 1128757922 15:70195925-70195947 GGCCTGCTCTCCCACACACGTGG No data
1128757915_1128757926 17 Left 1128757915 15:70195894-70195916 CCAACGGAGCCAAGCCGACAGCC No data
Right 1128757926 15:70195934-70195956 TCCCACACACGTGGGAATGAGGG No data
1128757915_1128757923 9 Left 1128757915 15:70195894-70195916 CCAACGGAGCCAAGCCGACAGCC No data
Right 1128757923 15:70195926-70195948 GCCTGCTCTCCCACACACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128757915 Original CRISPR GGCTGTCGGCTTGGCTCCGT TGG (reversed) Intergenic