ID: 1128757916

View in Genome Browser
Species Human (GRCh38)
Location 15:70195896-70195918
Sequence AACGGAGCCAAGCCGACAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128757912_1128757916 -10 Left 1128757912 15:70195883-70195905 CCCCAGACAGGCCAACGGAGCCA No data
Right 1128757916 15:70195896-70195918 AACGGAGCCAAGCCGACAGCCGG No data
1128757901_1128757916 30 Left 1128757901 15:70195843-70195865 CCCCAGGGCCTTGCTGATGGCAG No data
Right 1128757916 15:70195896-70195918 AACGGAGCCAAGCCGACAGCCGG No data
1128757902_1128757916 29 Left 1128757902 15:70195844-70195866 CCCAGGGCCTTGCTGATGGCAGG No data
Right 1128757916 15:70195896-70195918 AACGGAGCCAAGCCGACAGCCGG No data
1128757911_1128757916 -9 Left 1128757911 15:70195882-70195904 CCCCCAGACAGGCCAACGGAGCC No data
Right 1128757916 15:70195896-70195918 AACGGAGCCAAGCCGACAGCCGG No data
1128757904_1128757916 28 Left 1128757904 15:70195845-70195867 CCAGGGCCTTGCTGATGGCAGGC No data
Right 1128757916 15:70195896-70195918 AACGGAGCCAAGCCGACAGCCGG No data
1128757905_1128757916 22 Left 1128757905 15:70195851-70195873 CCTTGCTGATGGCAGGCTGACTG No data
Right 1128757916 15:70195896-70195918 AACGGAGCCAAGCCGACAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128757916 Original CRISPR AACGGAGCCAAGCCGACAGC CGG Intergenic
No off target data available for this crispr