ID: 1128757918

View in Genome Browser
Species Human (GRCh38)
Location 15:70195903-70195925
Sequence CTCTCTCCCGGCTGTCGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128757918_1128757922 -1 Left 1128757918 15:70195903-70195925 CCAAGCCGACAGCCGGGAGAGAG No data
Right 1128757922 15:70195925-70195947 GGCCTGCTCTCCCACACACGTGG No data
1128757918_1128757926 8 Left 1128757918 15:70195903-70195925 CCAAGCCGACAGCCGGGAGAGAG No data
Right 1128757926 15:70195934-70195956 TCCCACACACGTGGGAATGAGGG No data
1128757918_1128757923 0 Left 1128757918 15:70195903-70195925 CCAAGCCGACAGCCGGGAGAGAG No data
Right 1128757923 15:70195926-70195948 GCCTGCTCTCCCACACACGTGGG No data
1128757918_1128757925 7 Left 1128757918 15:70195903-70195925 CCAAGCCGACAGCCGGGAGAGAG No data
Right 1128757925 15:70195933-70195955 CTCCCACACACGTGGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128757918 Original CRISPR CTCTCTCCCGGCTGTCGGCT TGG (reversed) Intergenic
No off target data available for this crispr