ID: 1128757919

View in Genome Browser
Species Human (GRCh38)
Location 15:70195904-70195926
Sequence CAAGCCGACAGCCGGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128757914_1128757919 -4 Left 1128757914 15:70195885-70195907 CCAGACAGGCCAACGGAGCCAAG No data
Right 1128757919 15:70195904-70195926 CAAGCCGACAGCCGGGAGAGAGG No data
1128757911_1128757919 -1 Left 1128757911 15:70195882-70195904 CCCCCAGACAGGCCAACGGAGCC No data
Right 1128757919 15:70195904-70195926 CAAGCCGACAGCCGGGAGAGAGG No data
1128757912_1128757919 -2 Left 1128757912 15:70195883-70195905 CCCCAGACAGGCCAACGGAGCCA No data
Right 1128757919 15:70195904-70195926 CAAGCCGACAGCCGGGAGAGAGG No data
1128757913_1128757919 -3 Left 1128757913 15:70195884-70195906 CCCAGACAGGCCAACGGAGCCAA No data
Right 1128757919 15:70195904-70195926 CAAGCCGACAGCCGGGAGAGAGG No data
1128757905_1128757919 30 Left 1128757905 15:70195851-70195873 CCTTGCTGATGGCAGGCTGACTG No data
Right 1128757919 15:70195904-70195926 CAAGCCGACAGCCGGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128757919 Original CRISPR CAAGCCGACAGCCGGGAGAG AGG Intergenic
No off target data available for this crispr