ID: 1128757920

View in Genome Browser
Species Human (GRCh38)
Location 15:70195908-70195930
Sequence CAGGCCTCTCTCCCGGCTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128757920_1128757925 2 Left 1128757920 15:70195908-70195930 CCGACAGCCGGGAGAGAGGCCTG No data
Right 1128757925 15:70195933-70195955 CTCCCACACACGTGGGAATGAGG No data
1128757920_1128757926 3 Left 1128757920 15:70195908-70195930 CCGACAGCCGGGAGAGAGGCCTG No data
Right 1128757926 15:70195934-70195956 TCCCACACACGTGGGAATGAGGG No data
1128757920_1128757922 -6 Left 1128757920 15:70195908-70195930 CCGACAGCCGGGAGAGAGGCCTG No data
Right 1128757922 15:70195925-70195947 GGCCTGCTCTCCCACACACGTGG No data
1128757920_1128757929 26 Left 1128757920 15:70195908-70195930 CCGACAGCCGGGAGAGAGGCCTG No data
Right 1128757929 15:70195957-70195979 CTGCTGAGTCACTGCCCAGCTGG No data
1128757920_1128757923 -5 Left 1128757920 15:70195908-70195930 CCGACAGCCGGGAGAGAGGCCTG No data
Right 1128757923 15:70195926-70195948 GCCTGCTCTCCCACACACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128757920 Original CRISPR CAGGCCTCTCTCCCGGCTGT CGG (reversed) Intergenic
No off target data available for this crispr