ID: 1128757921

View in Genome Browser
Species Human (GRCh38)
Location 15:70195915-70195937
Sequence GGGAGAGCAGGCCTCTCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128757921_1128757926 -4 Left 1128757921 15:70195915-70195937 CCGGGAGAGAGGCCTGCTCTCCC No data
Right 1128757926 15:70195934-70195956 TCCCACACACGTGGGAATGAGGG No data
1128757921_1128757929 19 Left 1128757921 15:70195915-70195937 CCGGGAGAGAGGCCTGCTCTCCC No data
Right 1128757929 15:70195957-70195979 CTGCTGAGTCACTGCCCAGCTGG No data
1128757921_1128757925 -5 Left 1128757921 15:70195915-70195937 CCGGGAGAGAGGCCTGCTCTCCC No data
Right 1128757925 15:70195933-70195955 CTCCCACACACGTGGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128757921 Original CRISPR GGGAGAGCAGGCCTCTCTCC CGG (reversed) Intergenic
No off target data available for this crispr