ID: 1128757923

View in Genome Browser
Species Human (GRCh38)
Location 15:70195926-70195948
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128757920_1128757923 -5 Left 1128757920 15:70195908-70195930 CCGACAGCCGGGAGAGAGGCCTG No data
Right 1128757923 15:70195926-70195948 GCCTGCTCTCCCACACACGTGGG No data
1128757912_1128757923 20 Left 1128757912 15:70195883-70195905 CCCCAGACAGGCCAACGGAGCCA No data
Right 1128757923 15:70195926-70195948 GCCTGCTCTCCCACACACGTGGG No data
1128757911_1128757923 21 Left 1128757911 15:70195882-70195904 CCCCCAGACAGGCCAACGGAGCC No data
Right 1128757923 15:70195926-70195948 GCCTGCTCTCCCACACACGTGGG No data
1128757915_1128757923 9 Left 1128757915 15:70195894-70195916 CCAACGGAGCCAAGCCGACAGCC No data
Right 1128757923 15:70195926-70195948 GCCTGCTCTCCCACACACGTGGG No data
1128757918_1128757923 0 Left 1128757918 15:70195903-70195925 CCAAGCCGACAGCCGGGAGAGAG No data
Right 1128757923 15:70195926-70195948 GCCTGCTCTCCCACACACGTGGG No data
1128757913_1128757923 19 Left 1128757913 15:70195884-70195906 CCCAGACAGGCCAACGGAGCCAA No data
Right 1128757923 15:70195926-70195948 GCCTGCTCTCCCACACACGTGGG No data
1128757914_1128757923 18 Left 1128757914 15:70195885-70195907 CCAGACAGGCCAACGGAGCCAAG No data
Right 1128757923 15:70195926-70195948 GCCTGCTCTCCCACACACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128757923 Original CRISPR GCCTGCTCTCCCACACACGT GGG Intergenic