ID: 1128757929

View in Genome Browser
Species Human (GRCh38)
Location 15:70195957-70195979
Sequence CTGCTGAGTCACTGCCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128757928_1128757929 -2 Left 1128757928 15:70195936-70195958 CCACACACGTGGGAATGAGGGCT No data
Right 1128757929 15:70195957-70195979 CTGCTGAGTCACTGCCCAGCTGG No data
1128757924_1128757929 7 Left 1128757924 15:70195927-70195949 CCTGCTCTCCCACACACGTGGGA No data
Right 1128757929 15:70195957-70195979 CTGCTGAGTCACTGCCCAGCTGG No data
1128757920_1128757929 26 Left 1128757920 15:70195908-70195930 CCGACAGCCGGGAGAGAGGCCTG No data
Right 1128757929 15:70195957-70195979 CTGCTGAGTCACTGCCCAGCTGG No data
1128757927_1128757929 -1 Left 1128757927 15:70195935-70195957 CCCACACACGTGGGAATGAGGGC No data
Right 1128757929 15:70195957-70195979 CTGCTGAGTCACTGCCCAGCTGG No data
1128757921_1128757929 19 Left 1128757921 15:70195915-70195937 CCGGGAGAGAGGCCTGCTCTCCC No data
Right 1128757929 15:70195957-70195979 CTGCTGAGTCACTGCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128757929 Original CRISPR CTGCTGAGTCACTGCCCAGC TGG Intergenic