ID: 1128759993

View in Genome Browser
Species Human (GRCh38)
Location 15:70210074-70210096
Sequence ATAAATAGACTGATGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128759988_1128759993 28 Left 1128759988 15:70210023-70210045 CCATAAATGGTAGCAGAATCAGT No data
Right 1128759993 15:70210074-70210096 ATAAATAGACTGATGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128759993 Original CRISPR ATAAATAGACTGATGAAGGA GGG Intergenic
No off target data available for this crispr