ID: 1128762372

View in Genome Browser
Species Human (GRCh38)
Location 15:70226109-70226131
Sequence GGTCTAGGTAGACAAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128762365_1128762372 25 Left 1128762365 15:70226061-70226083 CCTAGGAAGTACTGATGCTGGTC No data
Right 1128762372 15:70226109-70226131 GGTCTAGGTAGACAAGAAGGAGG No data
1128762369_1128762372 -4 Left 1128762369 15:70226090-70226112 CCATACTTGGCATTGTACTGGTC No data
Right 1128762372 15:70226109-70226131 GGTCTAGGTAGACAAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128762372 Original CRISPR GGTCTAGGTAGACAAGAAGG AGG Intergenic
No off target data available for this crispr