ID: 1128764947

View in Genome Browser
Species Human (GRCh38)
Location 15:70245641-70245663
Sequence CTGTATGTTTCTATAAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128764943_1128764947 1 Left 1128764943 15:70245617-70245639 CCACTGAAGAAAGGAGAATGGAC No data
Right 1128764947 15:70245641-70245663 CTGTATGTTTCTATAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128764947 Original CRISPR CTGTATGTTTCTATAAGGAG AGG Intergenic
No off target data available for this crispr