ID: 1128766312

View in Genome Browser
Species Human (GRCh38)
Location 15:70253200-70253222
Sequence TGGGAAAGAACATAGGGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128766312_1128766319 4 Left 1128766312 15:70253200-70253222 CCAAGTCCCTATGTTCTTTCCCA No data
Right 1128766319 15:70253227-70253249 TCTTTCCTTCCAAGCACCCCCGG No data
1128766312_1128766322 7 Left 1128766312 15:70253200-70253222 CCAAGTCCCTATGTTCTTTCCCA No data
Right 1128766322 15:70253230-70253252 TTCCTTCCAAGCACCCCCGGGGG No data
1128766312_1128766329 26 Left 1128766312 15:70253200-70253222 CCAAGTCCCTATGTTCTTTCCCA No data
Right 1128766329 15:70253249-70253271 GGGGCTGCCGCCCCAAAGCGAGG No data
1128766312_1128766321 6 Left 1128766312 15:70253200-70253222 CCAAGTCCCTATGTTCTTTCCCA No data
Right 1128766321 15:70253229-70253251 TTTCCTTCCAAGCACCCCCGGGG No data
1128766312_1128766330 27 Left 1128766312 15:70253200-70253222 CCAAGTCCCTATGTTCTTTCCCA No data
Right 1128766330 15:70253250-70253272 GGGCTGCCGCCCCAAAGCGAGGG No data
1128766312_1128766320 5 Left 1128766312 15:70253200-70253222 CCAAGTCCCTATGTTCTTTCCCA No data
Right 1128766320 15:70253228-70253250 CTTTCCTTCCAAGCACCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128766312 Original CRISPR TGGGAAAGAACATAGGGACT TGG (reversed) Intergenic