ID: 1128766312 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:70253200-70253222 |
Sequence | TGGGAAAGAACATAGGGACT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 6 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1128766312_1128766319 | 4 | Left | 1128766312 | 15:70253200-70253222 | CCAAGTCCCTATGTTCTTTCCCA | No data | ||
Right | 1128766319 | 15:70253227-70253249 | TCTTTCCTTCCAAGCACCCCCGG | No data | ||||
1128766312_1128766322 | 7 | Left | 1128766312 | 15:70253200-70253222 | CCAAGTCCCTATGTTCTTTCCCA | No data | ||
Right | 1128766322 | 15:70253230-70253252 | TTCCTTCCAAGCACCCCCGGGGG | No data | ||||
1128766312_1128766329 | 26 | Left | 1128766312 | 15:70253200-70253222 | CCAAGTCCCTATGTTCTTTCCCA | No data | ||
Right | 1128766329 | 15:70253249-70253271 | GGGGCTGCCGCCCCAAAGCGAGG | No data | ||||
1128766312_1128766321 | 6 | Left | 1128766312 | 15:70253200-70253222 | CCAAGTCCCTATGTTCTTTCCCA | No data | ||
Right | 1128766321 | 15:70253229-70253251 | TTTCCTTCCAAGCACCCCCGGGG | No data | ||||
1128766312_1128766330 | 27 | Left | 1128766312 | 15:70253200-70253222 | CCAAGTCCCTATGTTCTTTCCCA | No data | ||
Right | 1128766330 | 15:70253250-70253272 | GGGCTGCCGCCCCAAAGCGAGGG | No data | ||||
1128766312_1128766320 | 5 | Left | 1128766312 | 15:70253200-70253222 | CCAAGTCCCTATGTTCTTTCCCA | No data | ||
Right | 1128766320 | 15:70253228-70253250 | CTTTCCTTCCAAGCACCCCCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1128766312 | Original CRISPR | TGGGAAAGAACATAGGGACT TGG (reversed) | Intergenic | ||