ID: 1128766313

View in Genome Browser
Species Human (GRCh38)
Location 15:70253206-70253228
Sequence GAGGGCTGGGAAAGAACATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128766313_1128766330 21 Left 1128766313 15:70253206-70253228 CCCTATGTTCTTTCCCAGCCCTC No data
Right 1128766330 15:70253250-70253272 GGGCTGCCGCCCCAAAGCGAGGG No data
1128766313_1128766333 27 Left 1128766313 15:70253206-70253228 CCCTATGTTCTTTCCCAGCCCTC No data
Right 1128766333 15:70253256-70253278 CCGCCCCAAAGCGAGGGCATGGG No data
1128766313_1128766331 26 Left 1128766313 15:70253206-70253228 CCCTATGTTCTTTCCCAGCCCTC No data
Right 1128766331 15:70253255-70253277 GCCGCCCCAAAGCGAGGGCATGG No data
1128766313_1128766334 28 Left 1128766313 15:70253206-70253228 CCCTATGTTCTTTCCCAGCCCTC No data
Right 1128766334 15:70253257-70253279 CGCCCCAAAGCGAGGGCATGGGG No data
1128766313_1128766322 1 Left 1128766313 15:70253206-70253228 CCCTATGTTCTTTCCCAGCCCTC No data
Right 1128766322 15:70253230-70253252 TTCCTTCCAAGCACCCCCGGGGG No data
1128766313_1128766329 20 Left 1128766313 15:70253206-70253228 CCCTATGTTCTTTCCCAGCCCTC No data
Right 1128766329 15:70253249-70253271 GGGGCTGCCGCCCCAAAGCGAGG No data
1128766313_1128766320 -1 Left 1128766313 15:70253206-70253228 CCCTATGTTCTTTCCCAGCCCTC No data
Right 1128766320 15:70253228-70253250 CTTTCCTTCCAAGCACCCCCGGG No data
1128766313_1128766321 0 Left 1128766313 15:70253206-70253228 CCCTATGTTCTTTCCCAGCCCTC No data
Right 1128766321 15:70253229-70253251 TTTCCTTCCAAGCACCCCCGGGG No data
1128766313_1128766335 29 Left 1128766313 15:70253206-70253228 CCCTATGTTCTTTCCCAGCCCTC No data
Right 1128766335 15:70253258-70253280 GCCCCAAAGCGAGGGCATGGGGG No data
1128766313_1128766319 -2 Left 1128766313 15:70253206-70253228 CCCTATGTTCTTTCCCAGCCCTC No data
Right 1128766319 15:70253227-70253249 TCTTTCCTTCCAAGCACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128766313 Original CRISPR GAGGGCTGGGAAAGAACATA GGG (reversed) Intergenic