ID: 1128766314

View in Genome Browser
Species Human (GRCh38)
Location 15:70253207-70253229
Sequence AGAGGGCTGGGAAAGAACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128766314_1128766334 27 Left 1128766314 15:70253207-70253229 CCTATGTTCTTTCCCAGCCCTCT No data
Right 1128766334 15:70253257-70253279 CGCCCCAAAGCGAGGGCATGGGG No data
1128766314_1128766321 -1 Left 1128766314 15:70253207-70253229 CCTATGTTCTTTCCCAGCCCTCT No data
Right 1128766321 15:70253229-70253251 TTTCCTTCCAAGCACCCCCGGGG No data
1128766314_1128766329 19 Left 1128766314 15:70253207-70253229 CCTATGTTCTTTCCCAGCCCTCT No data
Right 1128766329 15:70253249-70253271 GGGGCTGCCGCCCCAAAGCGAGG No data
1128766314_1128766333 26 Left 1128766314 15:70253207-70253229 CCTATGTTCTTTCCCAGCCCTCT No data
Right 1128766333 15:70253256-70253278 CCGCCCCAAAGCGAGGGCATGGG No data
1128766314_1128766330 20 Left 1128766314 15:70253207-70253229 CCTATGTTCTTTCCCAGCCCTCT No data
Right 1128766330 15:70253250-70253272 GGGCTGCCGCCCCAAAGCGAGGG No data
1128766314_1128766331 25 Left 1128766314 15:70253207-70253229 CCTATGTTCTTTCCCAGCCCTCT No data
Right 1128766331 15:70253255-70253277 GCCGCCCCAAAGCGAGGGCATGG No data
1128766314_1128766320 -2 Left 1128766314 15:70253207-70253229 CCTATGTTCTTTCCCAGCCCTCT No data
Right 1128766320 15:70253228-70253250 CTTTCCTTCCAAGCACCCCCGGG No data
1128766314_1128766335 28 Left 1128766314 15:70253207-70253229 CCTATGTTCTTTCCCAGCCCTCT No data
Right 1128766335 15:70253258-70253280 GCCCCAAAGCGAGGGCATGGGGG No data
1128766314_1128766319 -3 Left 1128766314 15:70253207-70253229 CCTATGTTCTTTCCCAGCCCTCT No data
Right 1128766319 15:70253227-70253249 TCTTTCCTTCCAAGCACCCCCGG No data
1128766314_1128766322 0 Left 1128766314 15:70253207-70253229 CCTATGTTCTTTCCCAGCCCTCT No data
Right 1128766322 15:70253230-70253252 TTCCTTCCAAGCACCCCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128766314 Original CRISPR AGAGGGCTGGGAAAGAACAT AGG (reversed) Intergenic