ID: 1128766323

View in Genome Browser
Species Human (GRCh38)
Location 15:70253232-70253254
Sequence AGCCCCCGGGGGTGCTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128766323_1128766333 1 Left 1128766323 15:70253232-70253254 CCTTCCAAGCACCCCCGGGGGCT No data
Right 1128766333 15:70253256-70253278 CCGCCCCAAAGCGAGGGCATGGG No data
1128766323_1128766334 2 Left 1128766323 15:70253232-70253254 CCTTCCAAGCACCCCCGGGGGCT No data
Right 1128766334 15:70253257-70253279 CGCCCCAAAGCGAGGGCATGGGG No data
1128766323_1128766330 -5 Left 1128766323 15:70253232-70253254 CCTTCCAAGCACCCCCGGGGGCT No data
Right 1128766330 15:70253250-70253272 GGGCTGCCGCCCCAAAGCGAGGG No data
1128766323_1128766331 0 Left 1128766323 15:70253232-70253254 CCTTCCAAGCACCCCCGGGGGCT No data
Right 1128766331 15:70253255-70253277 GCCGCCCCAAAGCGAGGGCATGG No data
1128766323_1128766335 3 Left 1128766323 15:70253232-70253254 CCTTCCAAGCACCCCCGGGGGCT No data
Right 1128766335 15:70253258-70253280 GCCCCAAAGCGAGGGCATGGGGG No data
1128766323_1128766329 -6 Left 1128766323 15:70253232-70253254 CCTTCCAAGCACCCCCGGGGGCT No data
Right 1128766329 15:70253249-70253271 GGGGCTGCCGCCCCAAAGCGAGG No data
1128766323_1128766339 14 Left 1128766323 15:70253232-70253254 CCTTCCAAGCACCCCCGGGGGCT No data
Right 1128766339 15:70253269-70253291 AGGGCATGGGGGCAGAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128766323 Original CRISPR AGCCCCCGGGGGTGCTTGGA AGG (reversed) Intergenic