ID: 1128766324

View in Genome Browser
Species Human (GRCh38)
Location 15:70253236-70253258
Sequence CGGCAGCCCCCGGGGGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128766324_1128766335 -1 Left 1128766324 15:70253236-70253258 CCAAGCACCCCCGGGGGCTGCCG No data
Right 1128766335 15:70253258-70253280 GCCCCAAAGCGAGGGCATGGGGG No data
1128766324_1128766334 -2 Left 1128766324 15:70253236-70253258 CCAAGCACCCCCGGGGGCTGCCG No data
Right 1128766334 15:70253257-70253279 CGCCCCAAAGCGAGGGCATGGGG No data
1128766324_1128766333 -3 Left 1128766324 15:70253236-70253258 CCAAGCACCCCCGGGGGCTGCCG No data
Right 1128766333 15:70253256-70253278 CCGCCCCAAAGCGAGGGCATGGG No data
1128766324_1128766340 29 Left 1128766324 15:70253236-70253258 CCAAGCACCCCCGGGGGCTGCCG No data
Right 1128766340 15:70253288-70253310 GAGGTTCTGCAGCTCTCATGTGG No data
1128766324_1128766330 -9 Left 1128766324 15:70253236-70253258 CCAAGCACCCCCGGGGGCTGCCG No data
Right 1128766330 15:70253250-70253272 GGGCTGCCGCCCCAAAGCGAGGG No data
1128766324_1128766329 -10 Left 1128766324 15:70253236-70253258 CCAAGCACCCCCGGGGGCTGCCG No data
Right 1128766329 15:70253249-70253271 GGGGCTGCCGCCCCAAAGCGAGG No data
1128766324_1128766331 -4 Left 1128766324 15:70253236-70253258 CCAAGCACCCCCGGGGGCTGCCG No data
Right 1128766331 15:70253255-70253277 GCCGCCCCAAAGCGAGGGCATGG No data
1128766324_1128766339 10 Left 1128766324 15:70253236-70253258 CCAAGCACCCCCGGGGGCTGCCG No data
Right 1128766339 15:70253269-70253291 AGGGCATGGGGGCAGAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128766324 Original CRISPR CGGCAGCCCCCGGGGGTGCT TGG (reversed) Intergenic