ID: 1128766329

View in Genome Browser
Species Human (GRCh38)
Location 15:70253249-70253271
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128766310_1128766329 28 Left 1128766310 15:70253198-70253220 CCCCAAGTCCCTATGTTCTTTCC No data
Right 1128766329 15:70253249-70253271 GGGGCTGCCGCCCCAAAGCGAGG No data
1128766311_1128766329 27 Left 1128766311 15:70253199-70253221 CCCAAGTCCCTATGTTCTTTCCC No data
Right 1128766329 15:70253249-70253271 GGGGCTGCCGCCCCAAAGCGAGG No data
1128766313_1128766329 20 Left 1128766313 15:70253206-70253228 CCCTATGTTCTTTCCCAGCCCTC No data
Right 1128766329 15:70253249-70253271 GGGGCTGCCGCCCCAAAGCGAGG No data
1128766316_1128766329 6 Left 1128766316 15:70253220-70253242 CCAGCCCTCTTTCCTTCCAAGCA No data
Right 1128766329 15:70253249-70253271 GGGGCTGCCGCCCCAAAGCGAGG No data
1128766314_1128766329 19 Left 1128766314 15:70253207-70253229 CCTATGTTCTTTCCCAGCCCTCT No data
Right 1128766329 15:70253249-70253271 GGGGCTGCCGCCCCAAAGCGAGG No data
1128766317_1128766329 2 Left 1128766317 15:70253224-70253246 CCCTCTTTCCTTCCAAGCACCCC No data
Right 1128766329 15:70253249-70253271 GGGGCTGCCGCCCCAAAGCGAGG No data
1128766318_1128766329 1 Left 1128766318 15:70253225-70253247 CCTCTTTCCTTCCAAGCACCCCC No data
Right 1128766329 15:70253249-70253271 GGGGCTGCCGCCCCAAAGCGAGG No data
1128766315_1128766329 7 Left 1128766315 15:70253219-70253241 CCCAGCCCTCTTTCCTTCCAAGC No data
Right 1128766329 15:70253249-70253271 GGGGCTGCCGCCCCAAAGCGAGG No data
1128766323_1128766329 -6 Left 1128766323 15:70253232-70253254 CCTTCCAAGCACCCCCGGGGGCT No data
Right 1128766329 15:70253249-70253271 GGGGCTGCCGCCCCAAAGCGAGG No data
1128766324_1128766329 -10 Left 1128766324 15:70253236-70253258 CCAAGCACCCCCGGGGGCTGCCG No data
Right 1128766329 15:70253249-70253271 GGGGCTGCCGCCCCAAAGCGAGG No data
1128766312_1128766329 26 Left 1128766312 15:70253200-70253222 CCAAGTCCCTATGTTCTTTCCCA No data
Right 1128766329 15:70253249-70253271 GGGGCTGCCGCCCCAAAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128766329 Original CRISPR GGGGCTGCCGCCCCAAAGCG AGG Intergenic
No off target data available for this crispr