ID: 1128767115

View in Genome Browser
Species Human (GRCh38)
Location 15:70257967-70257989
Sequence GGTTCAGGCTTGAGTGCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128767111_1128767115 -5 Left 1128767111 15:70257949-70257971 CCCAGGGGCCATCTGAGGGGTTC No data
Right 1128767115 15:70257967-70257989 GGTTCAGGCTTGAGTGCTTTTGG No data
1128767107_1128767115 0 Left 1128767107 15:70257944-70257966 CCTTACCCAGGGGCCATCTGAGG No data
Right 1128767115 15:70257967-70257989 GGTTCAGGCTTGAGTGCTTTTGG No data
1128767112_1128767115 -6 Left 1128767112 15:70257950-70257972 CCAGGGGCCATCTGAGGGGTTCA No data
Right 1128767115 15:70257967-70257989 GGTTCAGGCTTGAGTGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128767115 Original CRISPR GGTTCAGGCTTGAGTGCTTT TGG Intergenic
No off target data available for this crispr