ID: 1128767466

View in Genome Browser
Species Human (GRCh38)
Location 15:70259920-70259942
Sequence GAGCAGCACCAACCACAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128767462_1128767466 -7 Left 1128767462 15:70259904-70259926 CCGTCTACCGGGACCTGAGCAGC No data
Right 1128767466 15:70259920-70259942 GAGCAGCACCAACCACAAGAGGG No data
1128767461_1128767466 -4 Left 1128767461 15:70259901-70259923 CCACCGTCTACCGGGACCTGAGC No data
Right 1128767466 15:70259920-70259942 GAGCAGCACCAACCACAAGAGGG No data
1128767460_1128767466 -3 Left 1128767460 15:70259900-70259922 CCCACCGTCTACCGGGACCTGAG No data
Right 1128767466 15:70259920-70259942 GAGCAGCACCAACCACAAGAGGG No data
1128767456_1128767466 25 Left 1128767456 15:70259872-70259894 CCTGGTGCAGGGCCTTGGGCTTC No data
Right 1128767466 15:70259920-70259942 GAGCAGCACCAACCACAAGAGGG No data
1128767457_1128767466 13 Left 1128767457 15:70259884-70259906 CCTTGGGCTTCTAACTCCCACCG No data
Right 1128767466 15:70259920-70259942 GAGCAGCACCAACCACAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128767466 Original CRISPR GAGCAGCACCAACCACAAGA GGG Intergenic
No off target data available for this crispr