ID: 1128767561

View in Genome Browser
Species Human (GRCh38)
Location 15:70260489-70260511
Sequence CTGCAGCAGCAGAATGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128767561_1128767566 8 Left 1128767561 15:70260489-70260511 CCACACTCATTCTGCTGCTGCAG No data
Right 1128767566 15:70260520-70260542 GTCCTGTTCTCAGGTCCTAGGGG No data
1128767561_1128767568 22 Left 1128767561 15:70260489-70260511 CCACACTCATTCTGCTGCTGCAG No data
Right 1128767568 15:70260534-70260556 TCCTAGGGGCTTTCACAGCCAGG No data
1128767561_1128767562 -1 Left 1128767561 15:70260489-70260511 CCACACTCATTCTGCTGCTGCAG No data
Right 1128767562 15:70260511-70260533 GTCCAGAGAGTCCTGTTCTCAGG No data
1128767561_1128767564 6 Left 1128767561 15:70260489-70260511 CCACACTCATTCTGCTGCTGCAG No data
Right 1128767564 15:70260518-70260540 GAGTCCTGTTCTCAGGTCCTAGG No data
1128767561_1128767565 7 Left 1128767561 15:70260489-70260511 CCACACTCATTCTGCTGCTGCAG No data
Right 1128767565 15:70260519-70260541 AGTCCTGTTCTCAGGTCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128767561 Original CRISPR CTGCAGCAGCAGAATGAGTG TGG (reversed) Intergenic
No off target data available for this crispr