ID: 1128768668

View in Genome Browser
Species Human (GRCh38)
Location 15:70266233-70266255
Sequence ACACTGGCAGAGATGGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128768668_1128768679 8 Left 1128768668 15:70266233-70266255 CCCCTCTCCATCTCTGCCAGTGT No data
Right 1128768679 15:70266264-70266286 CCGTGAGGCCAAGGGGCACCAGG No data
1128768668_1128768676 1 Left 1128768668 15:70266233-70266255 CCCCTCTCCATCTCTGCCAGTGT No data
Right 1128768676 15:70266257-70266279 ACCAGCACCGTGAGGCCAAGGGG No data
1128768668_1128768674 -1 Left 1128768668 15:70266233-70266255 CCCCTCTCCATCTCTGCCAGTGT No data
Right 1128768674 15:70266255-70266277 TCACCAGCACCGTGAGGCCAAGG No data
1128768668_1128768673 -7 Left 1128768668 15:70266233-70266255 CCCCTCTCCATCTCTGCCAGTGT No data
Right 1128768673 15:70266249-70266271 CCAGTGTCACCAGCACCGTGAGG No data
1128768668_1128768675 0 Left 1128768668 15:70266233-70266255 CCCCTCTCCATCTCTGCCAGTGT No data
Right 1128768675 15:70266256-70266278 CACCAGCACCGTGAGGCCAAGGG No data
1128768668_1128768680 14 Left 1128768668 15:70266233-70266255 CCCCTCTCCATCTCTGCCAGTGT No data
Right 1128768680 15:70266270-70266292 GGCCAAGGGGCACCAGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128768668 Original CRISPR ACACTGGCAGAGATGGAGAG GGG (reversed) Intergenic
No off target data available for this crispr