ID: 1128771861

View in Genome Browser
Species Human (GRCh38)
Location 15:70288972-70288994
Sequence AAAGGGGTTCTGAAGTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128771861_1128771878 30 Left 1128771861 15:70288972-70288994 CCTCCAGACTTCAGAACCCCTTT No data
Right 1128771878 15:70289025-70289047 CTGGGTAGGGTGGAGGAGCGGGG No data
1128771861_1128771872 16 Left 1128771861 15:70288972-70288994 CCTCCAGACTTCAGAACCCCTTT No data
Right 1128771872 15:70289011-70289033 CGTCAGTGACTACACTGGGTAGG No data
1128771861_1128771869 12 Left 1128771861 15:70288972-70288994 CCTCCAGACTTCAGAACCCCTTT No data
Right 1128771869 15:70289007-70289029 CTCCCGTCAGTGACTACACTGGG No data
1128771861_1128771876 28 Left 1128771861 15:70288972-70288994 CCTCCAGACTTCAGAACCCCTTT No data
Right 1128771876 15:70289023-70289045 CACTGGGTAGGGTGGAGGAGCGG No data
1128771861_1128771868 11 Left 1128771861 15:70288972-70288994 CCTCCAGACTTCAGAACCCCTTT No data
Right 1128771868 15:70289006-70289028 TCTCCCGTCAGTGACTACACTGG No data
1128771861_1128771875 23 Left 1128771861 15:70288972-70288994 CCTCCAGACTTCAGAACCCCTTT No data
Right 1128771875 15:70289018-70289040 GACTACACTGGGTAGGGTGGAGG No data
1128771861_1128771877 29 Left 1128771861 15:70288972-70288994 CCTCCAGACTTCAGAACCCCTTT No data
Right 1128771877 15:70289024-70289046 ACTGGGTAGGGTGGAGGAGCGGG No data
1128771861_1128771873 17 Left 1128771861 15:70288972-70288994 CCTCCAGACTTCAGAACCCCTTT No data
Right 1128771873 15:70289012-70289034 GTCAGTGACTACACTGGGTAGGG No data
1128771861_1128771874 20 Left 1128771861 15:70288972-70288994 CCTCCAGACTTCAGAACCCCTTT No data
Right 1128771874 15:70289015-70289037 AGTGACTACACTGGGTAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128771861 Original CRISPR AAAGGGGTTCTGAAGTCTGG AGG (reversed) Intergenic
No off target data available for this crispr