ID: 1128772495

View in Genome Browser
Species Human (GRCh38)
Location 15:70292608-70292630
Sequence ACGGACTGGCCAGGATCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128772484_1128772495 18 Left 1128772484 15:70292567-70292589 CCGTGCACAGACCTGTCTACTGG No data
Right 1128772495 15:70292608-70292630 ACGGACTGGCCAGGATCCCAGGG No data
1128772488_1128772495 7 Left 1128772488 15:70292578-70292600 CCTGTCTACTGGAGGGCTCCTGG No data
Right 1128772495 15:70292608-70292630 ACGGACTGGCCAGGATCCCAGGG No data
1128772483_1128772495 21 Left 1128772483 15:70292564-70292586 CCGCCGTGCACAGACCTGTCTAC No data
Right 1128772495 15:70292608-70292630 ACGGACTGGCCAGGATCCCAGGG No data
1128772482_1128772495 25 Left 1128772482 15:70292560-70292582 CCTTCCGCCGTGCACAGACCTGT No data
Right 1128772495 15:70292608-70292630 ACGGACTGGCCAGGATCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128772495 Original CRISPR ACGGACTGGCCAGGATCCCA GGG Intergenic
No off target data available for this crispr