ID: 1128772857

View in Genome Browser
Species Human (GRCh38)
Location 15:70295362-70295384
Sequence TGCCCATTAGAGCCACCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128772851_1128772857 9 Left 1128772851 15:70295330-70295352 CCCTCACCAAATTCAGTAGTCCT No data
Right 1128772857 15:70295362-70295384 TGCCCATTAGAGCCACCAAGAGG No data
1128772852_1128772857 8 Left 1128772852 15:70295331-70295353 CCTCACCAAATTCAGTAGTCCTC No data
Right 1128772857 15:70295362-70295384 TGCCCATTAGAGCCACCAAGAGG No data
1128772853_1128772857 3 Left 1128772853 15:70295336-70295358 CCAAATTCAGTAGTCCTCAGCCA No data
Right 1128772857 15:70295362-70295384 TGCCCATTAGAGCCACCAAGAGG No data
1128772848_1128772857 21 Left 1128772848 15:70295318-70295340 CCACCCAGGGCTCCCTCACCAAA No data
Right 1128772857 15:70295362-70295384 TGCCCATTAGAGCCACCAAGAGG No data
1128772850_1128772857 17 Left 1128772850 15:70295322-70295344 CCAGGGCTCCCTCACCAAATTCA No data
Right 1128772857 15:70295362-70295384 TGCCCATTAGAGCCACCAAGAGG No data
1128772849_1128772857 18 Left 1128772849 15:70295321-70295343 CCCAGGGCTCCCTCACCAAATTC No data
Right 1128772857 15:70295362-70295384 TGCCCATTAGAGCCACCAAGAGG No data
1128772847_1128772857 26 Left 1128772847 15:70295313-70295335 CCTTGCCACCCAGGGCTCCCTCA No data
Right 1128772857 15:70295362-70295384 TGCCCATTAGAGCCACCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128772857 Original CRISPR TGCCCATTAGAGCCACCAAG AGG Intergenic
No off target data available for this crispr