ID: 1128775239

View in Genome Browser
Species Human (GRCh38)
Location 15:70315509-70315531
Sequence AAGAGGACACAGAAGGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128775239_1128775245 0 Left 1128775239 15:70315509-70315531 CCTACATCCTTCTGTGTCCTCTT No data
Right 1128775245 15:70315532-70315554 CAACCAATTCACACTAATGGGGG No data
1128775239_1128775243 -2 Left 1128775239 15:70315509-70315531 CCTACATCCTTCTGTGTCCTCTT No data
Right 1128775243 15:70315530-70315552 TTCAACCAATTCACACTAATGGG No data
1128775239_1128775244 -1 Left 1128775239 15:70315509-70315531 CCTACATCCTTCTGTGTCCTCTT No data
Right 1128775244 15:70315531-70315553 TCAACCAATTCACACTAATGGGG No data
1128775239_1128775242 -3 Left 1128775239 15:70315509-70315531 CCTACATCCTTCTGTGTCCTCTT No data
Right 1128775242 15:70315529-70315551 CTTCAACCAATTCACACTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128775239 Original CRISPR AAGAGGACACAGAAGGATGT AGG (reversed) Intergenic
No off target data available for this crispr