ID: 1128775240

View in Genome Browser
Species Human (GRCh38)
Location 15:70315516-70315538
Sequence TTGGTTGAAGAGGACACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128775240_1128775243 -9 Left 1128775240 15:70315516-70315538 CCTTCTGTGTCCTCTTCAACCAA No data
Right 1128775243 15:70315530-70315552 TTCAACCAATTCACACTAATGGG No data
1128775240_1128775244 -8 Left 1128775240 15:70315516-70315538 CCTTCTGTGTCCTCTTCAACCAA No data
Right 1128775244 15:70315531-70315553 TCAACCAATTCACACTAATGGGG No data
1128775240_1128775249 25 Left 1128775240 15:70315516-70315538 CCTTCTGTGTCCTCTTCAACCAA No data
Right 1128775249 15:70315564-70315586 CCCATCCCCCTCCAATTGTATGG No data
1128775240_1128775245 -7 Left 1128775240 15:70315516-70315538 CCTTCTGTGTCCTCTTCAACCAA No data
Right 1128775245 15:70315532-70315554 CAACCAATTCACACTAATGGGGG No data
1128775240_1128775242 -10 Left 1128775240 15:70315516-70315538 CCTTCTGTGTCCTCTTCAACCAA No data
Right 1128775242 15:70315529-70315551 CTTCAACCAATTCACACTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128775240 Original CRISPR TTGGTTGAAGAGGACACAGA AGG (reversed) Intergenic
No off target data available for this crispr