ID: 1128775242

View in Genome Browser
Species Human (GRCh38)
Location 15:70315529-70315551
Sequence CTTCAACCAATTCACACTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128775240_1128775242 -10 Left 1128775240 15:70315516-70315538 CCTTCTGTGTCCTCTTCAACCAA No data
Right 1128775242 15:70315529-70315551 CTTCAACCAATTCACACTAATGG No data
1128775239_1128775242 -3 Left 1128775239 15:70315509-70315531 CCTACATCCTTCTGTGTCCTCTT No data
Right 1128775242 15:70315529-70315551 CTTCAACCAATTCACACTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128775242 Original CRISPR CTTCAACCAATTCACACTAA TGG Intergenic
No off target data available for this crispr