ID: 1128775243

View in Genome Browser
Species Human (GRCh38)
Location 15:70315530-70315552
Sequence TTCAACCAATTCACACTAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128775240_1128775243 -9 Left 1128775240 15:70315516-70315538 CCTTCTGTGTCCTCTTCAACCAA No data
Right 1128775243 15:70315530-70315552 TTCAACCAATTCACACTAATGGG No data
1128775239_1128775243 -2 Left 1128775239 15:70315509-70315531 CCTACATCCTTCTGTGTCCTCTT No data
Right 1128775243 15:70315530-70315552 TTCAACCAATTCACACTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128775243 Original CRISPR TTCAACCAATTCACACTAAT GGG Intergenic
No off target data available for this crispr