ID: 1128775244 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:70315531-70315553 |
Sequence | TCAACCAATTCACACTAATG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1128775239_1128775244 | -1 | Left | 1128775239 | 15:70315509-70315531 | CCTACATCCTTCTGTGTCCTCTT | No data | ||
Right | 1128775244 | 15:70315531-70315553 | TCAACCAATTCACACTAATGGGG | No data | ||||
1128775240_1128775244 | -8 | Left | 1128775240 | 15:70315516-70315538 | CCTTCTGTGTCCTCTTCAACCAA | No data | ||
Right | 1128775244 | 15:70315531-70315553 | TCAACCAATTCACACTAATGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1128775244 | Original CRISPR | TCAACCAATTCACACTAATG GGG | Intergenic | ||
No off target data available for this crispr |