ID: 1128775245

View in Genome Browser
Species Human (GRCh38)
Location 15:70315532-70315554
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128775240_1128775245 -7 Left 1128775240 15:70315516-70315538 CCTTCTGTGTCCTCTTCAACCAA No data
Right 1128775245 15:70315532-70315554 CAACCAATTCACACTAATGGGGG No data
1128775239_1128775245 0 Left 1128775239 15:70315509-70315531 CCTACATCCTTCTGTGTCCTCTT No data
Right 1128775245 15:70315532-70315554 CAACCAATTCACACTAATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128775245 Original CRISPR CAACCAATTCACACTAATGG GGG Intergenic