ID: 1128777176

View in Genome Browser
Species Human (GRCh38)
Location 15:70329412-70329434
Sequence ATGTCCAAGGGGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128777176_1128777187 21 Left 1128777176 15:70329412-70329434 CCCTCCTCCCTCCCCTTGGACAT No data
Right 1128777187 15:70329456-70329478 GTCCTTTTAGATCCAACCGGTGG No data
1128777176_1128777186 18 Left 1128777176 15:70329412-70329434 CCCTCCTCCCTCCCCTTGGACAT No data
Right 1128777186 15:70329453-70329475 TTAGTCCTTTTAGATCCAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128777176 Original CRISPR ATGTCCAAGGGGAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr