ID: 1128777198

View in Genome Browser
Species Human (GRCh38)
Location 15:70329513-70329535
Sequence ATAAGTTGTCTGGCCAACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128777198_1128777202 -9 Left 1128777198 15:70329513-70329535 CCCAAGTTGGCCAGACAACTTAT No data
Right 1128777202 15:70329527-70329549 ACAACTTATCCTCTGATTGGTGG No data
1128777198_1128777203 -8 Left 1128777198 15:70329513-70329535 CCCAAGTTGGCCAGACAACTTAT No data
Right 1128777203 15:70329528-70329550 CAACTTATCCTCTGATTGGTGGG No data
1128777198_1128777206 11 Left 1128777198 15:70329513-70329535 CCCAAGTTGGCCAGACAACTTAT No data
Right 1128777206 15:70329547-70329569 TGGGGTCACACATCATTCCAAGG No data
1128777198_1128777204 -7 Left 1128777198 15:70329513-70329535 CCCAAGTTGGCCAGACAACTTAT No data
Right 1128777204 15:70329529-70329551 AACTTATCCTCTGATTGGTGGGG No data
1128777198_1128777208 17 Left 1128777198 15:70329513-70329535 CCCAAGTTGGCCAGACAACTTAT No data
Right 1128777208 15:70329553-70329575 CACACATCATTCCAAGGGAATGG No data
1128777198_1128777207 12 Left 1128777198 15:70329513-70329535 CCCAAGTTGGCCAGACAACTTAT No data
Right 1128777207 15:70329548-70329570 GGGGTCACACATCATTCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128777198 Original CRISPR ATAAGTTGTCTGGCCAACTT GGG (reversed) Intergenic
No off target data available for this crispr