ID: 1128777473

View in Genome Browser
Species Human (GRCh38)
Location 15:70333363-70333385
Sequence ATATGTACTCTGCAGGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128777468_1128777473 24 Left 1128777468 15:70333316-70333338 CCAGCACTTGGTCTGTTTTATTG No data
Right 1128777473 15:70333363-70333385 ATATGTACTCTGCAGGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128777473 Original CRISPR ATATGTACTCTGCAGGTGTG GGG Intergenic
No off target data available for this crispr